rs13306561 chr1:11805747 A>G

Sequence
cactaatcccgcgaagggtgcgca[A/G]gggaggcggcagccccccccaaga
ASB in cell types
SUM159PT (Triple negative breast cancer) RMG-1 CD14+ monocytes
ASB for transcription factors
ARI1A_HUMAN

Color scale

color scale ref
-log10 FDR of Ref (A) ASB
color scale alt
-log10 FDR of Alt (G) ASB

Details

Uniprot ID
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
Motif fold change
Motif concordance
ARI1A_HUMAN 2.52 -1.15 5.0·10-31.00 2.00 n/a No Hit
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI pulse pressure x alcohol consumption interaction (2df test) red blood cell folate levels
GRASP adiponectin levels advanced age-related macular degeneration atrial fibrillation comorbid depressive syndrome and alcohol dependence coronary artery disease (cad) diabetic retinopathy in type 2 diabetes mellitus diastolic blood pressure (clinic) diastolic blood pressure (dbp) diastolic blood pressure (mean 24-hour excluding subjects on antihypertensive treatment) diastolic blood pressure (mean 24-hour) homocysteine levels n-terminal signal peptide of pro-b-type natriuretic peptide blood level systolic blood pressure (sbp) systolic blood pressure (sbp), 24 hour mean systolic blood pressure (sbp), clinic measurements total cholesterol change with statins waist hip ratio
GTEx eQTL Adipose_Subcutaneous Adipose_Visceral_Omentum Artery_Tibial Brain_Cerebellar_Hemisphere Brain_Cerebellum Brain_Nucleus_accumbens_basal_ganglia Brain_Putamen_basal_ganglia Brain_Spinal_cord_cervical_c-1 Cells_Cultured_fibroblasts Cells_EBV-transformed_lymphocytes Esophagus_Gastroesophageal_Junction Esophagus_Mucosa Esophagus_Muscularis Muscle_Skeletal Pancreas Skin_Not_Sun_Exposed_Suprapubic Skin_Sun_Exposed_Lower_leg Testis Thyroid Whole_Blood

Download