rs13306879 chr7:155209219 G>A
- Sequence
ctacattcggggcacataggtgac[G/A]ccccccagctgtgagggcaggtgc
- ASB in cell types
- HKC8 (kidney proximal tubule cell line) EA.hy 926 (human umbilical vein endothelial cell line)
- ASB for transcription factors
- EPAS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EPAS1_HUMAN | -0.24 | 1.09 | 1.00 | 0.19 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
