rs13307585 chr7:11728006 G>A
- Sequence
cctaaggtgtttgtaagaagttct[G/A]aagtgttgtaagaacttgttactc
- ASB in cell types
- MOLM14 (Adult acute myeloid leukemia)
- ASB for transcription factors
- CDK8_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDK8_HUMAN | 1.78 | 0.45 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, hip bone mineral density (bmd), obesity with early age of onset (age >2), parkinsons disease, total cholesterol