rs13313629 chr18:79381167 C>T
- Sequence
acaagcaatccctgaaacggcgtc[C/T]ccaggaaggccagtttgctctagc
- ASB in cell types
- tibial artery
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| tibial artery | 2.41 | -2.11 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP decrease in fev1 (in nonasthmatic participants >=30 years old), decrease in fev1 (in nonasthmatic participants), hdl cholesterol, ldl cholesterol, lung function, forced expiratory volume in 1 second (fev1) percent predicted (in nonasthmatic participants), microalbuminuria, obesity with early age of onset (age >2), total cholesterol