rs133278 chr22:25421046 C>G
- Sequence
ctgaaggagcggtgggcggcgcgc[C/G]gcgaccctggcgggctacagatta
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) A673 (Ewing sarcoma)
- ASB for transcription factors
- IKZF1_HUMAN EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 2.67 | -2.54 | 1.00 | n/a | n/a | |||
| EZH2_HUMAN | -1.85 | 2.24 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial