rs13329848 chr16:78437502 C>T
- Sequence
tggctgcctgcaatataataatca[C/T]taatgagaaactcacaggaatcaa
- ASB in cell types
- hepatocytes MCF10CA1a (breast metastatic epithelial cells) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| hepatocytes | 1.47 | -0.08 | 1.00 | |||
| MCF10CA1a (breast metastatic epithelial cells) | -2.33 | 2.58 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | -0.65 | 0.73 | 1.00 |
Items per page:
1 – 3 of 3