rs13330390 chr16:84368527 G>T
- Sequence
caggtagacagctacctggtaacc[G/T]ggtccggcccaggaggcttgggcg
- ASB in cell types
- keratinocytes
- ASB for transcription factors
- SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | 2.47 | -4.47 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1