rs13331631 chr16:2687634 G>C
- Sequence
taaagcctcgccagggctgtggcc[G/C]tgatgggggcgcctgctgcctggt
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -3.95 | 4.02 | 2.50 | 3.99 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
