rs13336206 chr16:1923961 C>T
- Sequence
gccagtcccccatcctaccctccc[C/T]gagggcccgctgttcccagttcac
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) GM19193 (female B-cells Lymphoblastoid Cell Lines) 2588 (Lymphoblastoid Cell Lines) GM12890 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.66 | 2.19 | 1.39 | -3.11 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
