rs13339474 chr16:20245499 A>C
- Sequence
ctcccttgatttctatcctggaag[A/C]ctgcaaggacccctgcaggatgct
- ASB in cell types
- bipolar neuron
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.06 | 2.28 | 1.17 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, body mass index (bmi), college completion, fasting blood glucose, infant head circumference, mitral annular calcium, triglycerides change with statins