rs13356633 chr5:142441827 C>T
- Sequence
tcttgacatatgcagctcagactc[C/T]tcctcacttggcccttcctcgtca
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) K562 (myelogenous leukemia)
- ASB for transcription factors
- SPI1_HUMAN REST_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -0.58 | 2.31 | 1.00 | 5.06 | Concordant | |||
| REST_HUMAN | 2.56 | -4.79 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP body mass index (bmi), diastolic blood pressure (dbp), infant head circumference, microalbuminuria, obesity with early age of onset (age >2), salmonella-induced pyroptosis, systolic blood pressure (sbp), urinary albumin-to-creatinine ratio