rs13361707 chr5:40791782 C>T

Sequence
gcattccaaatacccatgagccac[C/T]atcagcttaagcaataaaacatta
ASB in cell types
HEK293 (embryonic kidney)

Color scale

color scale ref
-log10 FDR of Ref (C) ASB
color scale alt
-log10 FDR of Alt (T) ASB

Details

Cell type
Effect size Ref
Effect size Alt
FDR Ref
FDR Alt
Mean BAD
HEK293 (embryonic kidney) 0.02 1.04 1.001.5·10-3 3.02
Items per page:
1 – 1 of 1

Motif analysis

No data available

Genetic associations

EMBL-EBI gastric cancer non-cardia gastric cancer
GRASP college completion crohns disease, combined control dataset diastolic blood pressure (dbp) irritible bowel syndrome major depressive disorder major depressive disorder (females) non-cardia gastric cancer non-cardia gastric cancer (female) non-cardia gastric cancer (in <60 years old) non-cardia gastric cancer (in =60 years old) non-cardia gastric cancer (in drinkers) non-cardia gastric cancer (in non-drinkers) non-cardia gastric cancer (in non-smokers) non-cardia gastric cancer (in smokers) non-cardia gastric cancer (male) non-cardia gastric cancer vs cardia gastric cancer ptger4 gene expression in lymphoblastoid cell lines recurrent early onset major depressive disorder rheumatoid arthritis triglycerides
GTEx eQTL Adipose_Subcutaneous Artery_Tibial Esophagus_Mucosa Heart_Left_Ventricle Lung Muscle_Skeletal Nerve_Tibial Pancreas Skin_Not_Sun_Exposed_Suprapubic Skin_Sun_Exposed_Lower_leg Stomach

Download