rs13379855 chr15:72342632 T>C
- Sequence
cgagacatttccttctagagaaaa[T/C]cacacctgcaaagaccctctccag
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | -0.39 | 0.83 | 1.17 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -0.69 | 1.10 | 1.00 |
Items per page:
1 – 2 of 2