rs13381442 chr18:9914913 C>G
- Sequence
ctgccccggcccggggagagctcg[C/G]tgcagccggccctcgggttccgcg
- ASB in cell types
- MV-4-11 (Childhood acute monocytic leukemia) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MV-4-11 (Childhood acute monocytic leukemia) | 0.50 | 2.65 | 1.00 | |||
| K562 (myelogenous leukemia) | 0.59 | 0.69 | 1.15 |
Items per page:
1 – 2 of 2