rs13383650 chr2:139209670 G>A
- Sequence
tattaagagtgtgggatgatgatg[G/A]aaggaacatagagttggatcaagc
- ASB in cell types
- A549 (lung carcinoma)
- ASB for transcription factors
- MAFK_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MAFK_HUMAN | n/a | 2.69 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, diastolic blood pressure (dbp), ldl cholesterol, serum creatinine, systolic blood pressure (sbp)