rs13388721 chr2:16483477 C>T
- Sequence
tcattggatttagacccaatcata[C/T]tggaaatgacagtagcttatgatt
- ASB in cell types
- NGP (neuroblastoma)
- ASB for transcription factors
- MYCN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MYCN_HUMAN | -0.86 | 2.94 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1