rs13388780 chr2:12173686 A>C
- Sequence
tatgtaatctatctttttttttgc[A/C]agtttgaaggactgaaggagcaga
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -2.56 | 2.48 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1