rs13389956 chr2:179247914 C>G
- Sequence
atgaaaaatgaaactacaatatat[C/G]caaatatatggaacatagctaagg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ELF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF1_HUMAN | -2.13 | 2.53 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Cells_EBV-transformed_lymphocytes, Lung, Spleen, Whole_Blood