rs13390489 chr2:217102187 A>G
- Sequence
tgagatctggttgttcgaaagtgt[A/G]tagcacttcccctttctttctccc
- ASB in cell types
- macrophages form periferal blood ML-2 (cell line derived from HL60 M4 cell line, adult acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | 2.59 | -4.36 | 2.00 | |||
| ML-2 (cell line derived from HL60 M4 cell line, adult acute myeloid leukemia) | -2.08 | 2.45 | 1.00 |
Items per page:
1 – 2 of 2