rs13390830 chr2:118122753 T>C
- Sequence
gtgctttccttccaataaactctt[T/C]aaaaatgatttaaaagttgagtgg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.28 | -1.54 | 2.00 | -0.47 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, aortic valve calcium, cystatin c in serum, diastolic blood pressure (dbp), fasting blood glucose, fasting insulin, homa-ir, suicide attempts in bipolar disorder, suicide attempts in bipolar disorder (females), systolic blood pressure (sbp)
GTEx eQTL Adipose_Visceral_Omentum, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Muscle_Skeletal, Thyroid, Whole_Blood