rs13394603 chr2:74875397 T>C
- Sequence
ggctggtgtgcaatggcgcaatct[T/C]ggctcaccgcaatctctgcctccc
- ASB in cell types
- macrophages
- ASB for transcription factors
- CEBPA_HUMAN CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPA_HUMAN | 2.05 | n/a | 2.00 | n/a | No Hit | |||
| CEBPB_HUMAN | 1.11 | -0.18 | 1.42 | -0.20 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Lung, Muscle_Skeletal, Ovary, Testis, Whole_Blood