rs13396100 chr2:174335686 A>T
- Sequence
ctgcaagtttcgcccgtccctggc[A/T]gctgtttcggccgcctccgccctc
- ASB in cell types
- K562 (myelogenous leukemia) TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.46 | 1.02 | 1.14 | |||
| TTC-1240 (Rhabdoid tumor of the kidney) | -1.11 | 1.63 | 1.50 |
Items per page:
1 – 2 of 2