rs13396907 chr2:118122517 G>A
- Sequence
aaaaataaaatatgacaaaaatga[G/A]ggtaaacgtaaaaaacagaaaaca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.16 | 0.53 | 1.09 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, aortic valve calcium, cystatin c in serum, diastolic blood pressure (dbp), fasting blood glucose, fasting insulin, homa-ir, suicide attempts in bipolar disorder, suicide attempts in bipolar disorder (females), systolic blood pressure (sbp)