rs13398594 chr2:60796913 G>A
- Sequence
aagcaagagttccctatgaacacg[G/A]aaggaaatattcattgcatacttg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) monocyte-derived dendritic cells CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.63 | 0.94 | 1.08 | |||
| monocyte-derived dendritic cells | 1.87 | n/a | 2.00 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.92 | 1.32 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood