rs13403648 chr2:37787198 A>T
- Sequence
agtgccttgctgctatcctcaact[A/T]ctccggttgcaaggatttttaata
- ASB in cell types
- keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| keratinocytes | 1.27 | 0.00 | 1.17 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, birth weight, hdl cholesterol, homa-b, mitral annular calcium