rs13406798 chr2:9782672 A>G
- Sequence
tttggtaattctcgcaatatttca[A/G]actttttccttattattatatctg
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 1.01 | -0.93 | 1.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -0.17 | 1.91 | 1.00 |
Items per page:
1 – 2 of 2