rs13411781 chr2:38085456 G>A
- Sequence
tggggcgcggaaataagagattgg[G/A]cgcagagataagaggtcggggcac
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 1.37 | -3.75 | 2.00 | 0.09 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Esophagus_Muscularis, Liver, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Stomach, Thyroid