rs13413917 chr2:37832711 G>T
- Sequence
caaatccctttttgtaaaggcatt[G/T]actgggccactgttttgcacagct
- ASB in cell types
- hepatocytes liver MOLM14 (Adult acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| hepatocytes | -1.07 | 1.77 | 1.00 | |||
| liver | -0.23 | 1.90 | 1.00 | |||
| MOLM14 (Adult acute myeloid leukemia) | -0.17 | 1.09 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Lung, Nerve_Tibial, Spleen, Whole_Blood