rs13423765 chr2:237438364 A>G
- Sequence
cctgtgcaggtaactgcaggtgac[A/G]tagcctgtagatcctccacccagg
- ASB in cell types
- pancreas
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.06 | 1.59 | 1.04 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, height, maternal transmission distortion, multiple sclerosis severity scale, resistance to kuru in aged women despite likely exposure, stabilized warfarin dose, tetrology of fallot, transmission distortion, triglycerides change with statins