rs13425009 chr2:185280255 C>T
- Sequence
tctgaaacattgcaataacaatta[C/T]catgggcttgttgagtttctactg
- ASB in cell types
- MM1.S (plasma cell myeloma) SYO-1(Biphasic synovial sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MM1.S (plasma cell myeloma) | 1.75 | -0.91 | 1.00 | |||
| SYO-1(Biphasic synovial sarcoma) | 1.83 | -1.54 | 1.00 |
Items per page:
1 – 2 of 2