rs13426578 chr2:212767104 G>A
- Sequence
cgaacataaaagtatttttatact[G/A]tggaaatgtacatgcaaagtttgt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MCF7 WS8 cells
- ASB for transcription factors
- FOXA1_HUMAN GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 1.00 | -0.26 | 1.63 | 0.10 | Weak Discordant | |||
| GATA3_HUMAN | 2.70 | -0.03 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP diastolic blood pressure (dbp), infant head circumference, ldl cholesterol, mitral annular calcium