rs13427697 chr2:13007029 T>C
- Sequence
ggagggagcaaacccacctagtgc[T/C]agaggacaaacacaccccgttctt
- ASB in cell types
- foreskin keratinocyte K562 (myelogenous leukemia) neutrophils from periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.15 | n/a | 2.33 | |||
| K562 (myelogenous leukemia) | 0.14 | 0.73 | 2.00 | |||
| neutrophils from periferal blood | 1.56 | -0.19 | 1.50 |
Items per page:
1 – 3 of 3