rs13428964 chr2:11506766 G>A
- Sequence
ccagagttggagcagcagagcagc[G/A]tggaaccctgagctctggactctc
- ASB in cell types
- HepG2 (hepatoblastoma) liver
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.78 | 0.02 | 1.99 | |||
| liver | 1.39 | -0.60 | 1.50 |
Items per page:
1 – 2 of 2