rs13431933 chr2:158848533 G>C
- Sequence
caccttgctgcgtttggggaattc[G/C]cgcgctgcctcagaggctcgaaaa
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) 2588 (Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines) MCF7L-P(immortalized breast epithelial cell line)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.53 | 1.48 | 1.06 | n/a | n/a |
Items per page:
1 – 1 of 1