rs13432107 chr2:216404247 A>C
- Sequence
aattctaatccaaccttaacattt[A/C]acatctgtagacaaaaatgcactt
- ASB in cell types
- MM1.S (plasma cell myeloma) GM18486 (Lymphoblastoid Cell Lines) H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MM1.S (plasma cell myeloma) | 1.60 | -0.11 | 1.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 0.83 | -0.83 | 1.00 | |||
| H929 (plasma cell myeloma) | 1.21 | -1.21 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid