rs13437240 chr6:167218575 C>T
- Sequence
gttttgctacggctgagttcacca[C/T]aggcgccatgtgttcttcatgctg
- ASB in cell types
- Ishikawa (endometrial adenocarcinoma) FT282 (normal human fallopian tube tissue) NB69 (neuroblastoma) bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Ishikawa (endometrial adenocarcinoma) | 2.73 | -2.47 | 1.00 | |||
| FT282 (normal human fallopian tube tissue) | 2.54 | -2.58 | 1.00 | |||
| NB69 (neuroblastoma) | 2.39 | -2.06 | 1.00 | |||
| bipolar neuron | 1.99 | 0.02 | 1.00 | |||
| CUTLL1 (T-cell lymphoblastic lymphoma 1) | 2.27 | n/a | 1.00 |
Items per page:
1 – 5 of 7