rs13438969 chr8:144277690 A>G
- Sequence
ggcagggggcagaggtggccttcg[A/G]aggtgctgggttcccaggggcgca
- ASB in cell types
- epithelial cell of prostate GM19238 (female B-cells lymphoblastoid cell lines) GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epithelial cell of prostate | -1.47 | 1.47 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -0.00 | 1.75 | 1.17 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 1.16 | -1.01 | 1.00 |
Items per page:
1 – 3 of 3