rs135572 chr22:46131362 T>G
- Sequence
gccagggctgacgccaccgtaagg[T/G]tacagggcaggggtcactcctgct
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) HT1080 (fibrosarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | 1.83 | -3.15 | 1.33 | |||
| HT1080 (fibrosarcoma) | 1.58 | -0.48 | 2.00 |
Items per page:
1 – 2 of 2