rs135573 chr22:46131359 A>G
- Sequence
ggtgccagggctgacgccaccgta[A/G]ggttacagggcaggggtcactcct
- ASB in cell types
- HT1080 (fibrosarcoma) GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HT1080 (fibrosarcoma) | 1.61 | -0.44 | 2.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 1.76 | -3.22 | 1.42 |
Items per page:
1 – 2 of 2