rs1372048 chr8:94455013 T>G
- Sequence
ctctcagcctacaacatactacct[T/G]aaaacaaaaacacaacaaaactct
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.75 | 0.37 | 1.13 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol change with statins, obesity with early age of onset (age >2), total cholesterol change with statins, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood