rs1372513 chr4:89869086 G>A
- Sequence
gtaaaggctgtaattctataattt[G/A]atctacttgtgtttctgaagctaa
- ASB in cell types
- foreskin keratinocyte neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.54 | -3.23 | 2.00 | |||
| neural cell | -0.56 | 1.41 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP mitral annular calcium, obesity with early age of onset (age >2), urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Pituitary, Spleen, Whole_Blood