rs1373125 chr17:7131262 T>C
- Sequence
atctgcctcattccgtacttcggc[T/C]gttccctcctccacaggctctctc
- ASB in cell types
- monocyte-derived dendritic cells monocyte-derived macrophages from peripheral blood macrophages form periferal blood
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.86 | 0.11 | 1.60 | -0.94 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
