rs1374188 chr2:37982256 G>T
- Sequence
gaagtacaaaccatttcctcaaag[G/T]agacctcttttttcactctgccac
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) CD34+ stem cells-derived erythroblasts transverse colon
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.21 | 1.34 | 1.25 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hypothalamus, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Minor_Salivary_Gland, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid