rs1374261 chr2:225799601 G>C
- Sequence
cagcaggaacagcagctctccccc[G/C]cagactctcagcaaacatagcttc
- ASB in cell types
- VCaP (prostate carcinoma) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 1.74 | -0.14 | 2.00 | |||
| 22RV1 (prostate carcinoma) | -3.86 | 1.73 | 2.00 |
Items per page:
1 – 2 of 2