rs137585 chr22:39287439 G>A
- Sequence
tacacttggtggtggaaataacag[G/A]catttattctcatagctctggagg
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) GM18486 (Lymphoblastoid Cell Lines) GM12892 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | -2.93 | 3.24 | 1.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 2.41 | -0.50 | 1.00 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | -0.86 | 1.53 | 1.00 |
Items per page:
1 – 3 of 3