rs1377059 chr4:81351807 A>G
- Sequence
cacaccctttaaagcagagaagtg[A/G]catctacctgcttacactttctgg
- ASB in cell types
- foreskin keratinocyte erythroid progenitors HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 0.69 | 2.50 | |||
| erythroid progenitors | 2.95 | n/a | 2.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.37 | -0.71 | 1.00 |
Items per page:
1 – 3 of 3