rs1377692 chr6:67145842 C>A
- Sequence
aaacattcaatccttagcatgaca[C/A]ctcattacaatttggagagagtga
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.92 | n/a | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease with psychotic symptoms (alzheimers disease with psychotic symptoms v. alzheimers disease without psychotic symptoms), alzheimers disease with psychotic symptoms (alzheimers disease with psychotic symptoms v. controls)