rs1378577 chr21:42199555 T>G
- Sequence
tgctgctttacgcccagtgacttg[T/G]gagggaacagaactgccctttagt
- ASB in cell types
- MDM(monocyte derived macrophages) keratinocytes
- ASB for transcription factors
- SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | 2.38 | n/a | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, hdl cholesterol, tetrology of fallot, total cholesterol, triglycerides, urinary albumin-to-creatinine ratio