rs1378942 chr15:74785026 C>A
- Sequence
gaatctgagctcattatagggaaa[C/A]catgaatgtactcattttcttgat
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.62 | -1.14 | 2.28 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI blood pressure, coronary artery disease and total cholesterol levels (multivariate analysis), diastolic blood pressure, diastolic blood pressure (cigarette smoking interaction), systemic lupus erythematosus, systolic blood pressure, systolic blood pressure (cigarette smoking interaction)
GRASP adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, bipolar disorder, body mass index (bmi), cardiac neonatal lupus, celiac disease, childhood acute lymphoblastic leukemia, coffee consumption, concentration of idl particles, coronary artery disease (cad), diastolic blood pressure (dbp), diastolic blood pressure (dbp) (female), diastolic blood pressure (dbp) (male), fasting blood glucose, free cholesterol in idl particles, free cholesterol in large ldl particles, gene expression of csk in blood, gene expression of ulk3 in blood, gene expression of ulk3 in monocytes, habitual caffeine consumption, homa-b, hypertension, hypertension (early onset hypertension), infant head circumference, ldl cholesterol, mean arterial pressure, phospholipids in idl particles, phospholipids in very small vldl particles, pulse pressure, salmonella-induced pyroptosis, systolic blood pressure (sbp), systolic blood pressure (sbp), extremes in sbp, total cholesterol, total cholesterol in idl particles, total lipids in idl particles, total lipids in very small vldl cholesterol particles, years of education
PheWAS abnormal function study of cardiovascular system, acute pharyngitis, adjustment reaction, adverse effects of antilipemic and antiarteriosclerotic drugs, allergies, other, aneurysm of artery of lower extremity, anterior pituitary disorders, antihypertensive agents causing adverse effects, breast conditions, congenital or relating to hormones, carditis, cellulitis and abscess of hand/fingers, cervical radiculitis, cervicocranial/cervicobrachial syndrome, chronic renal failure, chronic sinusitis, conduct disorders, conductive hearing loss, congenital pigmentary anomalies of skin, derangement of joint, non-traumatic, dermatomyositis and polymyositis, disease of tricuspid valve, disorders of lacrimal system, disorders of other cranial nerves, disorders of sweat glands, dry eyes, encounter for long-term use of antiplatelets/antithrombotics, exophthalmos, facial nerve disorders, hallux rigidus, hallux valgus (bunion), hemoptysis, hypertension, inflammatory spondylopathies, internal derangement of knee, loose body in joint, miscarriage, stillbirth, musculoskeletal symptoms referable to limbs, nerve root and plexus disorders, nonrheumatic mitral valve disorders, orchitis and epididymitis, osteoporosis, osteoporosis, osteopenia, & pathological fractures, other abnormal glucose, other acquired musculoskeletal deformity, other aneurysm, other conditions of the mother complicating pregnancy, other endocrine disorders, overweight, paraproteinemia, peripheral arterial disease, phlebitis and thrombophlebitis, phlebitis and thrombophlebitis of lower extremities, pituitary hypofunction, plasma protein metabolism disorder, polymyalgia rheumatica, posttraumatic wound infection, precordial pain, protein plasma/amino-acid transport and metabolism disorder, secondary malignancy of brain/spine, secondary malignant neoplasm of liver, shock, spirochetal infection, symptoms involving respiratory system, systemic sclerosis, type 2 diabetic nephropathy, unequal leg length (acquired), vascular complications of surgery and medical procedures, vitamin d deficiency
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood