rs1378965 chr4:154982589 A>G
- Sequence
caagttgtgcccactggaaagggc[A/G]gagattgttactgagagagcgcag
- ASB in cell types
- foreskin keratinocyte A549 (lung carcinoma) GM12890 (Lymphoblastoid Cell Lines) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.56 | n/a | 2.00 | |||
| A549 (lung carcinoma) | 1.00 | 0.38 | 1.03 | |||
| GM12890 (Lymphoblastoid Cell Lines) | -0.85 | 1.07 | 1.00 | |||
| neural cell | 1.08 | -0.17 | 1.00 |
Items per page:
1 – 4 of 4